Journal: Molecules

Article Title: Synthesis and Antiproliferative Activity against Cancer Cells of Indole-Aryl-Amide Derivatives

doi: 10.3390/molecules28010265

Figure Lengend Snippet: In vitro cytotoxic activity of new compounds tested on two normal and six cancer cell lines, expressed as IC 50 [μM] a .

Article Snippet: HT29 human colorectal adenocarcinoma cells, HeLa human cervix adenocarcinoma cells, MCF7 human breast adenocarcinoma cells, PC-3 human prostate adenocarcinoma cells, J6 Jurkat Clone E6-1 acute T cell leukemia, the healthy I407 human intestine cells, and mouse embryonic fibroblast 3T3 fibroblasts as controls cell lines were purchased from American Type Culture Collection (ATCC, Manassas, VA).

Techniques: In Vitro, Activity Assay

Journal: Molecules

Article Title: Synthesis and Antiproliferative Activity against Cancer Cells of Indole-Aryl-Amide Derivatives

doi: 10.3390/molecules28010265

Figure Lengend Snippet: Selectivity indices of compounds against cancer cell lines (IC 50 ) using 3T3 or I407 normal cells (IC 50 ) as reference.

Article Snippet: HT29 human colorectal adenocarcinoma cells, HeLa human cervix adenocarcinoma cells, MCF7 human breast adenocarcinoma cells, PC-3 human prostate adenocarcinoma cells, J6 Jurkat Clone E6-1 acute T cell leukemia, the healthy I407 human intestine cells, and mouse embryonic fibroblast 3T3 fibroblasts as controls cell lines were purchased from American Type Culture Collection (ATCC, Manassas, VA).

Techniques:

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: IL-15 Trans-Signaling with the Superagonist RLI Promotes Effector/Memory CD8+ T Cell Responses and Enhances Antitumor Activity of PD-1 Antagonists.

doi: 10.4049/jimmunol.1600019

Figure Lengend Snippet: FIGURE 1. RLI induces the growth delay of solid tumor when initiated in absence of exhausted CD8+ T cells. Two protocols of RLI injections were assessed to determine the antitumor efficacy of RLI stand-alone. Two hundred thousand CT26 tumor cells were inoculated in s.c. in BALB/c mice. Mice received i.p. injections of RLI (2 mg/mouse) or control PBS four times per week from D5 to D22 (A, early treatment) or from D10 to D23 (B, late treatment). Left, Graphs show the CT26 tumor size (in mm2) over time after tumor inoculation. Each line represents a mouse. Middle, Graphs depict the mean 6 SD of PBS versus RLI tumor sizes in one representative experiment of several independent experiments (n = 6 mice per group). Right, Tumor sizes on D14 or D21 are presented from all pooled experiments. Data are pooled from (A) four (n = 21–23 mice per groups) or (B) three (n = 16–18 mice per groups) independent experiments. (C) Graphs depict the mean 6 SD of PBS versus RLI tumor sizes after CD8 depletion in one representative experiment of two independent experiments (n = 6 mice per group). Statistical significance was determined using the nonparametric t test with the Mann–Whitney U test and the two-way ANOVA with matched values and Sidak’s multiple comparisons test. *p , 0.05, **p , 0.01, ***p , 0.01, ****p , 0.0001. Lymphocytes infiltrating the tumor were detected by flow cytometry after mechanic and enzymatic dissociation of the fresh tumor on D5, D10, and D14. (D) Percentage of CD8+ T cells among viable CD45+ cells in the tumor is presented. (E) Representative dot plots of flow cytometry analyses regarding the PD-1/Tim-3 expression among CD8+ T cells. (F) The percentage of PD-1/Tim-3–expressing cells among total CD8+ T cells is shown for each subset. Data from two independent experiments are pooled (n = 9–10).

Article Snippet: Mouse colon carcinoma CT26 and MC38 cell lines (American Type Culture Collection) were cultured in RPMI 1640medium supplemented with 1 mM sodium/pyruvate, 1 mM nonessential amino acids, 100 IU/ml penicillin/streptomycin, 2 mM L-glutamine, and 10% FBS (Life Technologies, Saint Aubin, France).

Techniques: Control, MANN-WHITNEY, Cytometry, Expressing

Journal: Journal of immunology (Baltimore, Md. : 1950)

Article Title: IL-15 Trans-Signaling with the Superagonist RLI Promotes Effector/Memory CD8+ T Cell Responses and Enhances Antitumor Activity of PD-1 Antagonists.

doi: 10.4049/jimmunol.1600019

Figure Lengend Snippet: FIGURE 3. RLI but not IL-15 increases the antitumor efficacy of anti–PD-1 treatment. (A and B) Two hundred thousand CT26 cells were inoculated s.c. on D0. Mice were treated every 3 d with 250 mg anti–PD-1 or the rat IgG2a isotype control (2A3) on D9, D12, and D15. Mice received 2 mg RLI or PBS twice per week from D13 to D37. (A) Left, Graphs show the CT26 tumor size (in mm2) over time after tumor inoculation. Each line represents a mouse. Data from two independent experiments are pooled (n = 9–10). The number of complete tumor regressions is noted CR on each graph as well as the number of PR, determined by a tumor size ,100 mm2 40 d after tumor inoculation. Middle, Graph depicts the mean 6 SD tumor sizes in one representative experiment of two independent experiments (n = 5 mice per group). Right, Graph of survival is shown. (B) Mice that received anti–PD-1/RLI combination initially that became tumor free were injected s.c. with the same dose of CT26 cells on the opposite flank 145 d after the total regression. Without any treatment, tumor recurrence was recorded (n = 4). Naive BALB/c mice were used as controls (n = 8). (C) As in (A), but mice were treated with IL-15 (1.2 mg/mouse) or PBS administered i.p. twice per week from D13 to D23. Left, Graphs show the CT26 tumor size (in mm2) over time after tumor inoculation. Each line represents a mouse. Data from two independent experiments are pooled (n = 12). Middle, Graph depicts the mean 6 SD tumor sizes from one representative experiment of two independent experiments (n = 6 mice per group). Right, Graph of survival is shown. (D) As in (A), but with the MC38 tumor model in C56BL/6 mice. MC38 cells were inoculated s.c. on D0. Mice were treated every 3 d with 250 mg anti–PD-1 or the rat IgG2a isotype control (2A3) on D10, D13, and D16. Concomitantly, mice received 2 mg RLI or PBS twice per week from D11 to D24. Left panel represents the tumor growth over time. Data pooled from two experiments are shown (n = 12). Middle, Graph represents the mean 6 SD of the tumor growth over time from one rep- resentative experiment of two independent experiments (n = 6 mice per group). Right, Graph of survival is shown. Mice were sacrificed when they reached boundary points, as described in Materials and Methods. Statistical significance was determined using the log-rank (Mantel–Cox) test for survival experiments and the two-way ANOVA with matched values and Dunnett’s multiple comparisons test for graphs with tumor size. ****p , 0.0001, ***p , 0.001, **p , 0.01, * p , 0.05.

Article Snippet: Mouse colon carcinoma CT26 and MC38 cell lines (American Type Culture Collection) were cultured in RPMI 1640medium supplemented with 1 mM sodium/pyruvate, 1 mM nonessential amino acids, 100 IU/ml penicillin/streptomycin, 2 mM L-glutamine, and 10% FBS (Life Technologies, Saint Aubin, France).

Techniques: Control, Injection

Journal: Cancer immunology research

Article Title: IRF1 inhibits antitumor immunity through the upregulation of PD-L1 in the tumor cell

doi: 10.1158/2326-6066.CIR-18-0711

Figure Lengend Snippet: B16-F10 WT and IRF-1 KO cells were treated with mouse IFNγ for 0, 2, 4, 6 and 8 hrs, and collected for the detection of expression of PD-L1. (A-B) The mRNA expression of PD-L1 and ICAM1 were detected using TaqMan real-time PCR. (C) Total protein expression of PD-L1 was examined by immunoblotting. (D) The cell surface expression of PD-L1 was assessed by flow cytometry. (E) 5 × 105 of B16-F10 WT or IRF1-KO cells were intradermally injected into C57BL/6 mice (n=5). Tumor were collected on day 12 of post-injection. The percentage of and geometric mean (MFI) of PD-L1high in CD45− cells (tumor cells) were tested by flow cytometry. In (A) and (B) each data point represents mean and SEM from 3 independent replicates. Representative results from twice repeated experiment are shown in (C - F).

Article Snippet: Mouse PD-L1 coding region (PD-L1) was PCR amplified from pUNO mouse CD274 (Addgene Plasmid# 107012) using primers 5’- CACCATGAGGATATTTGCTGGCATTATAT TCAC - 3’) and 5’ - GAGTTTGGTGACTACATCTTAAGATCTATCATGTCGTC - 3, TOPO cloned into pENTR D-TOPO and transferred into pInducer20 vector using Gateway Cloning (Thermo Fisher Scientific).

Techniques: Expressing, Real-time Polymerase Chain Reaction, Western Blot, Flow Cytometry, Injection

Journal: Cancer immunology research

Article Title: IRF1 inhibits antitumor immunity through the upregulation of PD-L1 in the tumor cell

doi: 10.1158/2326-6066.CIR-18-0711

Figure Lengend Snippet: B16-F10 WT cells were treated with mouse IFNγ for 4 hrs for positive control. B16-F10 WT, IRF1-KO and IRF1-KO pInducer20-PD-L1 cells were treated with DOX for 48 hrs and collected for the detection of PD-L1expression. (A) Total protein expression of PD-L1 was examined by immunoblotting. (B) The cell surface expression of PD-L1 was assessed by flow cytometry. Representative histogram from twice repeated experiments are shown. (C) 5 × 105 of B16-F10 WT, IRF1-KO or IRF1-KO pInducer20-PD-L1 cells were intradermally injected into C57BL/6 mice (n=5). One group of either B16-F10 IRF1-KO or IRF1-KO pInducer20-PD-L1 cell injected mice were fed with DOX containing food (200 mg/kg) from 3 days before tumor cell injection, then continued being fed with DOX containing food. Tumor growth measurements were taken with all groups of mice.

Article Snippet: Mouse PD-L1 coding region (PD-L1) was PCR amplified from pUNO mouse CD274 (Addgene Plasmid# 107012) using primers 5’- CACCATGAGGATATTTGCTGGCATTATAT TCAC - 3’) and 5’ - GAGTTTGGTGACTACATCTTAAGATCTATCATGTCGTC - 3, TOPO cloned into pENTR D-TOPO and transferred into pInducer20 vector using Gateway Cloning (Thermo Fisher Scientific).

Techniques: Positive Control, Expressing, Western Blot, Flow Cytometry, Injection

Journal: Antioxidants

Article Title: Cystine and Methionine Deficiency Promotes Ferroptosis by Inducing B-Cell Translocation Gene 1

doi: 10.3390/antiox10101543

Figure Lengend Snippet: Oligonucleotide sequences used in the present study.

Article Snippet: An expression plasmid encoding mouse ATF4 was a gift from Dr. David Ron (Addgene plasmid #21845).

Techniques: Recombinant, Plasmid Preparation

Journal: Antioxidants

Article Title: Cystine and Methionine Deficiency Promotes Ferroptosis by Inducing B-Cell Translocation Gene 1

doi: 10.3390/antiox10101543

Figure Lengend Snippet: Cystine and methionine deficiency activates the integrated stress response (ISR). HepG2 and L-O2 cells were exposed to CST/Met (−) for 6 ( a , b ), 12 ( d , f ), 24 ( c , e ), or 24–36 h ( g ). ( a ) Phosphorylation of GCN2 and eIF2α. Equal protein loading was verified by β-actin immunoblotting. ( b ) SUnSET assay. Puromycin-integrated polypeptides of 25–170 kDa were quantified by densitometry (left and right). Equal protein loading was verified by Ponceau S staining (upper middle) and β-actin immunoblotting (lower middle). ( c ) ATF4 expression in cells exposed to CST/Met (−) with or without Fer-1 (10 μM) was normalized to β-actin. ( d ) mRNA levels of ISR target genes were determined by qPCR analysis. ( e – g ) Lipid peroxidation ( e ), PTGS2 mRNA ( f ), and cell viability ( g ) were determined after HepG2 cells were exposed to ISRIB (1 μM) under CST/Met (−). ** p < 0.01, * p < 0.05, versus control; ## p < 0.01, # p < 0.05, versus CST/Met (−): Con, control; ISRIB, ISR inhibitor; N.S., not significant.

Article Snippet: An expression plasmid encoding mouse ATF4 was a gift from Dr. David Ron (Addgene plasmid #21845).

Techniques: Phospho-proteomics, Western Blot, Staining, Expressing, Control

Journal: Antioxidants

Article Title: Cystine and Methionine Deficiency Promotes Ferroptosis by Inducing B-Cell Translocation Gene 1

doi: 10.3390/antiox10101543

Figure Lengend Snippet: Cystine and methionine deficiency induces BTG1 by activating ATF4. HepG2 and L-O2 cells were exposed to CST/Met (−) for 1–12 ( a , d ), or 24 h ( b , c , e , f ). ( a ) The level of BTG1 mRNA was determined by qPCR. Fer-1 (10 μM, 12 h) or ISRIB (1 μM, 12 h) was simultaneously applied to HepG2 cells under CST/Met (−) (left). ( b ) BTG1 protein. Open arrowheads and dashed lines in immunoblot images indicate nonspecific bands and cropped images of the same membrane, respectively (upper). ( c ) BTG1 transactivation. Schematic illustration of constructed reporter plasmids containing the human and murine BTG1 gene promoter (upper). An ATF4 expression plasmid was co-transfected with hpBTG1-luc, mpBTG1-luc, or mpBTG1-ΔA4RE-luc. pCDNA3.2/V5-DEST was used for mock transfection (lower). ( d – f ) Effect of siATF4 on BTG1 induction. A siRNA targeting human ATF4 ( d , e ) or murine ATF4 ( f ) was transfected into HepG2 cells, and expression of BTG1 ( d , e ) and transactivation ( f ) were determined by qPCR, immunoblot, and reporter gene assays, respectively. ** p < 0.01, * p < 0.05, versus control ( a , b , d , e ) or mock transfection ( c , f ); ## p < 0.01, # p < 0.05, versus HepG2 cells exposed to CST/Met (−) ( a , d , e ) or ATF4-transfected cells ( c , f ); †† p < 0.01, between basal level of ATF4 mRNA ( d ): A4RE, putative ATF4 response element; Con, control.

Article Snippet: An expression plasmid encoding mouse ATF4 was a gift from Dr. David Ron (Addgene plasmid #21845).

Techniques: Western Blot, Membrane, Construct, Expressing, Plasmid Preparation, Transfection, Control

Journal: Antioxidants

Article Title: Cystine and Methionine Deficiency Promotes Ferroptosis by Inducing B-Cell Translocation Gene 1

doi: 10.3390/antiox10101543

Figure Lengend Snippet: Putative ATF4 response elements in BTG1 promoter.

Article Snippet: An expression plasmid encoding mouse ATF4 was a gift from Dr. David Ron (Addgene plasmid #21845).

Techniques: Binding Assay, Sequencing

Journal: Antioxidants

Article Title: Cystine and Methionine Deficiency Promotes Ferroptosis by Inducing B-Cell Translocation Gene 1

doi: 10.3390/antiox10101543

Figure Lengend Snippet: BTG1 induces ferroptosis under cystine and methionine deficiency. WT and BTG1 KO HAP1 cells were exposed to CST/Met (−) for 1 ( a —lower), 12 ( c , e ), 24 ( a —upper, and b , d ), or 0–24 h ( f ). ( a ) Fluorescence intensity was measured after incubating HAP1 cells with CST/Met (−) and DCFH-DA (lower). The phenotype of BTG1 KO HAP1 cells was verified by BTG1 immunoblotting. Open arrowheads and dashed lines in immunoblot images indicate nonspecific bands and cropped images of the same membrane, respectively (upper). ( b ) Effect of BTG1 KO on CST/Met (−)-inducible expression of ATF4. ( c ) mRNA levels of ISR target genes in HAP1 cells. ( d – f ) Lipid peroxidation ( d ), PTGS2 mRNA level ( e ), and necrotic cell death ( f ) in HAP1 cells exposed to CST/Met (−). ** p < 0.01, * p < 0.05, versus control; ## p < 0.01, between HAP1 cells exposed to CST/Met (−); N.S., not significant.

Article Snippet: An expression plasmid encoding mouse ATF4 was a gift from Dr. David Ron (Addgene plasmid #21845).

Techniques: Fluorescence, Western Blot, Membrane, Expressing, Control

Journal: Cancer Medicine

Article Title: Schedule-dependent therapeutic efficacy of L19mTNF-α and melphalan combined with gemcitabine

doi: 10.1002/cam4.89

Figure Lengend Snippet: Administration schedules of gemcitabine (G) and L19mTNF-α/melphalan (L-M) as single or combined treatments

Article Snippet: WEHI-164 mouse fibrosarcoma (3 × 10 6 ) (ECACC, Sigma-Aldrich, Milan, Italy) and K7M2 mouse osteosarcoma (0.3 × 10 6 ) (American Type Culture Collection, Rockville, MD), all BALB/c origin, were subcutaneously (s.c.) implanted in the left flank of 8- to 10-week-old immunocompetent syngeneic BALB/c mice, purchased from Harlan UK (Oxon, U.K.).

Techniques: In Vivo

Journal: Cancer Medicine

Article Title: Schedule-dependent therapeutic efficacy of L19mTNF-α and melphalan combined with gemcitabine

doi: 10.1002/cam4.89

Figure Lengend Snippet: Therapeutic efficacy of the different schedules of drugs administration. Tumor-free survival curves (%) versus time (days) of WEHI-164 (A and B) and K7M2 (C and D) tumor-bearing mice subjected to G-G (black triangles), L-M (black circles), G-L-M-G (black asterisks), or L-M-G-G (black squares) administration schedules. Data are illustrative of at least 10 mice per treatment group.

Article Snippet: WEHI-164 mouse fibrosarcoma (3 × 10 6 ) (ECACC, Sigma-Aldrich, Milan, Italy) and K7M2 mouse osteosarcoma (0.3 × 10 6 ) (American Type Culture Collection, Rockville, MD), all BALB/c origin, were subcutaneously (s.c.) implanted in the left flank of 8- to 10-week-old immunocompetent syngeneic BALB/c mice, purchased from Harlan UK (Oxon, U.K.).

Techniques: Drug discovery

Journal: Cancer Medicine

Article Title: Schedule-dependent therapeutic efficacy of L19mTNF-α and melphalan combined with gemcitabine

doi: 10.1002/cam4.89

Figure Lengend Snippet: Immune population involved in WEHI-164 and K7M2 tumor eradication in in vivo -depleted mice. Tumor-free survival curves (%) versus time (days) of the WEHI-164 and K7M2 tumor-bearing mice subjected to G-G treatment, in vivo depleted with antibodies direct with CD4 + or CD8 + T cells as described in the Materials and Methods section. The tumor-free survival of groups of five WEHI-164 (A) and K7M2 (B) tumor-bearing mice subjected to G-G treatment (open squares), co-CD4-depleted (black triangles), co-CD8-depleted (black asterisks), or untreated tumor-bearing mice (black diamonds) is indicated. Specific cytolytic activity of the immune splenocytes after WEHI-164 and K7M2 tumor cure and persistence of antitumor memory. Specific lysis (%) of WEHI-164 (C) and K7M2 (D) cells by different E:T ratio of splenocytes from WEHI-164- and K7M2-cured mice at 6 months after G-G (open squares) or L-M-G-G (black diamonds) treatment and after s.c. tumor challenge. The specific lysis is totally inhibited by anti-MHC class I antibodies (open diamonds) and unaffected by anti-MHC class II antibodies (black asterisks). Results are representative of three independent 51 Chromium-release experiments with similar results. (E) The ability of WEHI-164- and K7M2-cured mice subjected to G-G and L-M-G-G treatments to reject the first tumor challenge at different times post cure. The number of challenged mice is indicated in round brackets.

Article Snippet: WEHI-164 mouse fibrosarcoma (3 × 10 6 ) (ECACC, Sigma-Aldrich, Milan, Italy) and K7M2 mouse osteosarcoma (0.3 × 10 6 ) (American Type Culture Collection, Rockville, MD), all BALB/c origin, were subcutaneously (s.c.) implanted in the left flank of 8- to 10-week-old immunocompetent syngeneic BALB/c mice, purchased from Harlan UK (Oxon, U.K.).

Techniques: In Vivo, Activity Assay, Lysis

Journal: Cancer Medicine

Article Title: Schedule-dependent therapeutic efficacy of L19mTNF-α and melphalan combined with gemcitabine

doi: 10.1002/cam4.89

Figure Lengend Snippet: Immunohistochemical assessment of tumor infiltrates. Immunohistochemical assessment of CD4 + T cells, CD8 + T cells, and Gr-1 + CD11b + MDSCs in untreated or treated WEHI-164 (A–C) and K7M2 (D–F) tumor-bearing mice 3 days after the conclusion of all therapeutic protocols. Untreated group of mice received PBS only. Results are expressed as cell number (mean ± SD) per high-magnification microscopic field (HMMF). Data are representative of at least three mice per each treatment group. *** P ≤ 0.001; ** P ≤ 0.01; * P ≤ 0.05.

Article Snippet: WEHI-164 mouse fibrosarcoma (3 × 10 6 ) (ECACC, Sigma-Aldrich, Milan, Italy) and K7M2 mouse osteosarcoma (0.3 × 10 6 ) (American Type Culture Collection, Rockville, MD), all BALB/c origin, were subcutaneously (s.c.) implanted in the left flank of 8- to 10-week-old immunocompetent syngeneic BALB/c mice, purchased from Harlan UK (Oxon, U.K.).

Techniques: Immunohistochemical staining

Journal: Cancer Medicine

Article Title: Schedule-dependent therapeutic efficacy of L19mTNF-α and melphalan combined with gemcitabine

doi: 10.1002/cam4.89

Figure Lengend Snippet: Tumor volume assessment after the different therapeutic treatments. Three days after the term of the all therapeutic protocols, the tumor volumes of WEHI-164 and K7M2 untreated and treated tumor-bearing mice were compared. Untreated mice received PBS only. Tumor volumes (cm 3 ) are expressed as mean ± SD. Data are illustrative of least 10 mice per each treatment group.

Article Snippet: WEHI-164 mouse fibrosarcoma (3 × 10 6 ) (ECACC, Sigma-Aldrich, Milan, Italy) and K7M2 mouse osteosarcoma (0.3 × 10 6 ) (American Type Culture Collection, Rockville, MD), all BALB/c origin, were subcutaneously (s.c.) implanted in the left flank of 8- to 10-week-old immunocompetent syngeneic BALB/c mice, purchased from Harlan UK (Oxon, U.K.).

Techniques:

Journal: Cancer Medicine

Article Title: Schedule-dependent therapeutic efficacy of L19mTNF-α and melphalan combined with gemcitabine

doi: 10.1002/cam4.89

Figure Lengend Snippet: Flow-cytometric assessment of regulatory T cells

Article Snippet: WEHI-164 mouse fibrosarcoma (3 × 10 6 ) (ECACC, Sigma-Aldrich, Milan, Italy) and K7M2 mouse osteosarcoma (0.3 × 10 6 ) (American Type Culture Collection, Rockville, MD), all BALB/c origin, were subcutaneously (s.c.) implanted in the left flank of 8- to 10-week-old immunocompetent syngeneic BALB/c mice, purchased from Harlan UK (Oxon, U.K.).

Techniques: