Journal: Oncotarget

Article Title: Src is the primary target of aripiprazole, an atypical antipsychotic drug, in its anti-tumor action.

doi: 10.18632/oncotarget.23192

Figure Lengend Snippet: Figure 1: In vitro and in vivo anti-cancer effects of aripiprazole (ARP). (A) Chemical structure of ARP, an antipsychotic to treat schizophrenia and bipolar disorder. (B, C, D, and E) Cytotoxic effect of ARP evaluated by conventional MTT assays. Viability of glioma U251 (B left) and LN428 (B right) cell lines, human gastric cancer cell line MKN-1 (C left), breast cancer line MDA-MB-231 (C right), mouse CT21 colon cancer cell line (D), and noncancerous HEK293 (E) cell line following ARP treatment for 24 and 48 h. (F) In vivo ARP anti-cancer activity evaluated using xenograft mice bearing CT26 cell-derived cancers. Mice were subcutaneously injected with 10,000 CT26 cells in 0.1 ml. Photograph of mice with CT26 cell-derived cancers by digital camera (upper). Tumor volumes were determined using digital calipers every 1, 2, or 3 days for 18 days (middle). Body weight was measured for 18 days at 3-day intervals (lower). *P < 0.05 and **P <0.01 compared with normal group. Data are presented as the mean ± standard error of the mean (SEM) of three independent experiments conducted in triplicate. *:p < 0.05 and **:p < 0.01 compared to normal or control groups.

Article Snippet: Cell lines and cell culture conditions The human glioma cell lines U251 and LN428, the human gastric adenosquamous carcinoma cancer cell Table 2: List of PCR primers used in this study Name Sequence (5′ to 3′) Real-time PCR Bcl-2 F GAAACCCCTAGTGCCATCAA R GGGACGTCAGGTCACTGAAT GAPDH F GGAAGGTGAAGGTCGGAGTCA R GTCATTGATGGCAACAATATCCACT RT-PCR Bcl-2 F TGTGGCCTTCTTTGAGTTCG R TCACTTGTGGCTCAGATAGG MMP-2 F CCCACTGAGGAGTCCAACAT R CATTTACACGTCGGATCT MMP-9 F TCCCTGGAGACCTGAGAACC R GGCAAGTCTTCCGAGTAGTTT GAPDH F GCACCGTCAAGGCTGAGAAC R ATGGTGGTGAAGACGCCAGT Oncotarget5986www.impactjournals.com/oncotarget Oncotarget5987www.impactjournals.com/oncotarget line MKN-1, the human breast cancer cell line MDAMB-231, the mouse colon carcinoma cell line CT26, and the human embryonic kidney cell line HEK293 were from the American Type Culture Collection (Manassas, VA, USA).

Techniques: In Vitro, In Vivo, Activity Assay, Derivative Assay, Injection, Control

Journal: Molecules

Article Title: Synthesis and Antiproliferative Activity against Cancer Cells of Indole-Aryl-Amide Derivatives

doi: 10.3390/molecules28010265

Figure Lengend Snippet: In vitro cytotoxic activity of new compounds tested on two normal and six cancer cell lines, expressed as IC 50 [μM] a .

Article Snippet: HT29 human colorectal adenocarcinoma cells, HeLa human cervix adenocarcinoma cells, MCF7 human breast adenocarcinoma cells, PC-3 human prostate adenocarcinoma cells, J6 Jurkat Clone E6-1 acute T cell leukemia, the healthy I407 human intestine cells, and mouse embryonic fibroblast 3T3 fibroblasts as controls cell lines were purchased from American Type Culture Collection (ATCC, Manassas, VA).

Techniques: In Vitro, Activity Assay

Journal: Molecules

Article Title: Synthesis and Antiproliferative Activity against Cancer Cells of Indole-Aryl-Amide Derivatives

doi: 10.3390/molecules28010265

Figure Lengend Snippet: Selectivity indices of compounds against cancer cell lines (IC 50 ) using 3T3 or I407 normal cells (IC 50 ) as reference.

Article Snippet: HT29 human colorectal adenocarcinoma cells, HeLa human cervix adenocarcinoma cells, MCF7 human breast adenocarcinoma cells, PC-3 human prostate adenocarcinoma cells, J6 Jurkat Clone E6-1 acute T cell leukemia, the healthy I407 human intestine cells, and mouse embryonic fibroblast 3T3 fibroblasts as controls cell lines were purchased from American Type Culture Collection (ATCC, Manassas, VA).

Techniques:

Journal: Nature Communications

Article Title: Thbs1 induces lethal cardiac atrophy through PERK-ATF4 regulated autophagy

doi: 10.1038/s41467-021-24215-4

Figure Lengend Snippet: a Representative western blots for ATF6α-N (50 kDa, nuclear), phospho-IRE1α (Ser 724; arrowhead), total IRE1α, phospho- and total PERK, phospho-eIF2α (Ser 51), total-eIF2α, ATF4, and DNAJC3. Phospho-PERK was analyzed using Phos-tag gels. The heart protein extracts are from the indicated mice at 4 weeks of age. Gapdh serves as a processing and loading control. b , c Western blot for Thbs1 and PERK following immunoprecipitation (IP) of PERK ( b ) or Thbs1 ( c ) from protein extracts of tTA cont. and Thbs1 DTG hearts at 6 weeks of age. IPs with corresponding IgG served as negative controls. Vinculin is an input loading control. d Schematic diagram of Thbs1 with the GST-Thbs1 fusion proteins regions shown (red bars). Below the schematic a representative western blot for PERK following GST pull-down with the different Thbs1 domains from primary neonatal rat ventricular cardiomyocyte extracts. GST protein serves as a negative control. e - i , Quantitative RT-PCR for Eif2ak3 (PERK protein; * P = 0.0317 vs tTA control), Atf4 (* P = 0.0006 vs tTA control), Atf3 (* P = 0.0058 vs tTA control), Ddit3 (Chop protein; * P < 0.0001 vs tTA control)) and Fgf21 (* P = 0.0023 vs tTA control) from mRNA isolated from hearts of tTA cont. (n = 6 biologically independent animals) and Thbs1 DTG mice (n = 5 biologically independent animals) at 6 weeks of age. Statistical analysis was performed using two-tailed Student’s t test. Error bars are ±standard error of the mean. Source data are provided as a Source Data File.

Article Snippet: Full-length mouse Atf4 cDNA was obtained from Addgene (plasmid #21845, deposited by Dr. David Ron), amplified by PCR using CloneAMP HiFi PCR premix (Takara Bio, #639298) and cloned into the Cla1 and XhoI sites of pAAV-MCS vector (Cell biolabs, #VPK-410) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, #E2621).

Techniques: Western Blot, Control, Immunoprecipitation, Negative Control, Quantitative RT-PCR, Isolation, Two Tailed Test

Journal: Nature Communications

Article Title: Thbs1 induces lethal cardiac atrophy through PERK-ATF4 regulated autophagy

doi: 10.1038/s41467-021-24215-4

Figure Lengend Snippet: a Low magnification images of wild type and Thbs1 −/− whole mount cardiac histological sections stained with Hematoxylin & Eosin, 2 weeks after TAC surgery at 8 weeks of age. Scale bar is 1 mm. b HW/BW ratio and c FS percentage 2 weeks after TAC or sham surgery at 8 weeks of age. The number of biologically independent animals analyzed is indicated on the graphs for panels “ b – d ”. d – p Quantitative RT-PCR results for Eif2ak3 (PERK protein) , Atf6, Ern1 (IRE1α protein) , Manf (Armet protein) , Hspa5 (BiP protein) , Calr (Calreticulin protein), Atf4, Atf3, Fgf21, Map1lc3b (LC3b protein) , Trim63 (MuRF1 protein) , Fbxo32 (Atrogin-1 protein), and Trib3 mRNA isolated from hearts of wild type and Thbs1 −/− mice, 2 weeks after TAC or sham surgery at 8 weeks of age. For panels “ d – i ”, n = 6 biologically independent samples per group; for panels “ j and p ”, n = 6 biologically independent samples for sham wild type and Thbs1 −/− 2 weeks after TAC surgery, n = 5 biologically independent samples for sham Thbs1 −/− and n = 9 biologically independent samples for wild-type 2 weeks after TAC surgery; for panels “ k – o ”, n = 6 biologically independent samples for sham wild-type, sham Thbs1 −/− and Thbs1 −/− 2 weeks after TAC surgery and n = 9 biologically independent samples for wild-type 2 weeks after TAC surgery. Data are represented as fold expression over sham wild type. All statistical analysis was performed using one-way ANOVA and Tukey multiple comparisons test. P -values are shown in each graph. Error bars are ±standard error of the mean. Source data are provided as a Source Data File.

Article Snippet: Full-length mouse Atf4 cDNA was obtained from Addgene (plasmid #21845, deposited by Dr. David Ron), amplified by PCR using CloneAMP HiFi PCR premix (Takara Bio, #639298) and cloned into the Cla1 and XhoI sites of pAAV-MCS vector (Cell biolabs, #VPK-410) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, #E2621).

Techniques: Staining, Quantitative RT-PCR, Isolation, Expressing

Journal: Nature Communications

Article Title: Thbs1 induces lethal cardiac atrophy through PERK-ATF4 regulated autophagy

doi: 10.1038/s41467-021-24215-4

Figure Lengend Snippet: a Low magnification cardiac histological images from tTA cont. Eif2ak3 fl/fl (PERK), tTA Eif2ak3 fl/fl βMHC-Cre ( Eif2ak3 CKO ), Thbs1 DTG Eif2ak3 fl/fl , and Thbs1 DTG Eif2ak3 CKO mice stained with Masson’s trichrome at 8 weeks of age. Scale bar is 2 mm. b VW/BW ratio, c FS percentage and d LW/BW ratio at 8 weeks of age in the indicated groups of mice. The number of biologically independent animals analyzed and P -values are indicated on the graphs for panels “ b – d ”. Statistical analysis was performed using one-way ANOVA and Tukey multiple comparisons test for panels “ b – d ”. Error bars are ±standard error of the mean. e Kaplan–Meier survival plot from tTA cont. Eif2ak3 fl/fl , Thbs1 DTG Eif2ak3 fl/fl , tTA cont. Eif2ak3 CKO and Thbs1 DTG Eif2ak3 CKO . The number of biologically independent animals analyzed are indicated on the graph. Statistical analysis was performed using a two-tailed log-rank test. *P < 0.0001 vs tTA cont. Eif2ak3 fl/fl , Eif2ak3 CKO and Thbs1 DTG Eif2ak3 CKO , # P = 0.0678 vs tTA cont. Eif2ak3 fl/fl , and # P = 0.0404 vs Eif2ak3 CKO . f Representative western blots for Thbs1, PERK, ATF4, LC3b, and p62 from cardiac protein extracts isolated from the groups shown at 8 weeks of age. Protein extracts were from dissociated adult mouse heart cardiomyocytes. Gapdh serves as a loading control. Source data are provided as a Source Data File.

Article Snippet: Full-length mouse Atf4 cDNA was obtained from Addgene (plasmid #21845, deposited by Dr. David Ron), amplified by PCR using CloneAMP HiFi PCR premix (Takara Bio, #639298) and cloned into the Cla1 and XhoI sites of pAAV-MCS vector (Cell biolabs, #VPK-410) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, #E2621).

Techniques: Staining, Two Tailed Test, Western Blot, Isolation, Control

Journal: Nature Communications

Article Title: Thbs1 induces lethal cardiac atrophy through PERK-ATF4 regulated autophagy

doi: 10.1038/s41467-021-24215-4

Figure Lengend Snippet: a Schematic diagram depicting the experimental protocol. Either 1E11 genomic copies of adeno-associated virus 9 (AAV9)-PERK or AAV9-luciferase (Lucif.) control were injected into the mediastinum of 7-day-old WT mouse pups. Hearts were harvested at 8 weeks of age for further analysis. b Low magnification of whole mount cardiac histological images from mice injected with AAV9-PERK or AAV9-Lucif. control stained with Masson’s trichrome at 8 weeks of age. Scale bar is 2 mm. c Representative western blots for PERK, ATF4, LC3b, and p62 from cardiac protein extracts of 8-week-old mice injected with either AAV9-Lucif. or AAV9-PERK. Gapdh serves as a loading control. d Representative western blot for ubiquitin-conjugated proteins (Ubiq.) and Gapdh as loading control on cardiac protein extracts of 8-week-old mice injected with either AAV9-Lucif. or AAV9-PERK. e HW/BW ratio (* P = 0.0051 vs AAV9-Lucif.) and f FS% at 8 weeks of age in the 2 indicated groups of mice. * P = 0.0060 vs AAV9-Lucif. g Representative immunohistochemistry for PERK (green), nuclei with DAPI (blue) and WGA (purple)-stained membranes from heart sections of AAV9-PERK or AAV9-Lucif. injected mice killed at 8 weeks of age. Scale bars are 100 μm. h Quantitative analysis of AAV9-Lucif. versus or AAV9-PERK positive (Pos.) and negative (Neg.) cross sectional area (CSA) determined by WGA staining of cardiac histological sections. * P = 0.0087 vs AAV9-Lucif. and * P = 0.0050 vs AAV9-PERK Neg. The number of biologically independent animals analyzed are indicated on the graphs. Statistical analysis was performed using a two-tailed Student’s t -test in panels “ e , f ”, and one-way ANOVA and Tukey multiple comparisons test in panel “ h ”. All error bars are ±standard error of the mean. Source data are provided as a Source Data File.

Article Snippet: Full-length mouse Atf4 cDNA was obtained from Addgene (plasmid #21845, deposited by Dr. David Ron), amplified by PCR using CloneAMP HiFi PCR premix (Takara Bio, #639298) and cloned into the Cla1 and XhoI sites of pAAV-MCS vector (Cell biolabs, #VPK-410) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, #E2621).

Techniques: Virus, Luciferase, Control, Injection, Staining, Western Blot, Ubiquitin Proteomics, Immunohistochemistry, Two Tailed Test

Journal: Nature Communications

Article Title: Thbs1 induces lethal cardiac atrophy through PERK-ATF4 regulated autophagy

doi: 10.1038/s41467-021-24215-4

Figure Lengend Snippet: a Schematic diagram depicting the experimental protocol. Either 0.5E11 or 1E10 genomic copies (gc) of AAV9-ATF4 or AAV9-Lucif. control were injected into the mediastinum of 7-day-old wild-type mouse pups. Hearts were harvested at 4 weeks of age for further analysis. b Representative western blots for PERK and ATF4 from cardiac protein extracts of 4-week-old mice treated with the indicated AAV9. Gapdh serves as a loading control. c , d Representative heart sections with Masson’s Trichrome staining ( c ) and immunohistochemistry for ATF4 (green) and WGA (purple)-stained membranes and nuclei with DAPI (blue) ( d ) of AAV9-ATF4 or AAV9-Lucif. injected mice (both 0.5E11 gc) at 4 weeks of age. Scale bars are 2 mm and 100 μm, respectively. e CSA of AAV9-Lucif. versus AAV9-ATF4 positive cardiomyocytes determined by ATF4 and WGA staining of histological sections as shown in panel “ d ”. * P = 0.0548 vs AAV9-Lucif. f Representative Masson’s trichrome stained images of hearts from mice injected with 1E10 gc AAV9-Lucif or -ATF4 and harvested at 4 weeks of age. Scale bar is 2 mm. g HW/BW ratio at 4 weeks of age in the indicated groups of mice. * P = 0.0235 vs AAV9-Lucif. h Representative immunohistochemistry for ATF4 (green), nuclei with DAPI (blue) and WGA (purple)-stained membranes from heart sections of AAV9-ATF4 or AAV9-Lucif. injected mice (both 1E10 gc) at 4 weeks of age. Scale bars are 100 μm. i CSA of ATF4 positive cardiomyocytes determined by ATF4 and WGA staining as shown in panel “ h ”. * P = 0.0116 vs AAV9-Lucif. j Representative western blots for LC3b, p62, and ubiquitin-conjugated proteins (Ubiq.) from cardiac protein extracts of 4-week-old mice treated with 1E10 gc AAV9-Lucif. or -ATF4. Gapdh serves as a loading control. k , l Representative micrographs of fluorescent LC3 puncta ( k ) and quantification thereof ( l ) in cultured primary neonatal rat ventricular myocytes 48 h after infection with adenoviruses to overexpress tandem mRFP-GFP-LC3 (Ad-tf-LC3) and ATF4 or βgal expressing control. Yellow dots represent autophagosomes, whereas red dots indicate autolysosomes. Scale bars are 50 μm. * P < 0.0001 vs Adβgal. Number of biologically independent animals or cells analyzed is indicated in each panel. All statistical analysis were performed using two-tailed Student’s t test. Error bars are ±standard error of the mean. Source data are provided as a Source Data File.

Article Snippet: Full-length mouse Atf4 cDNA was obtained from Addgene (plasmid #21845, deposited by Dr. David Ron), amplified by PCR using CloneAMP HiFi PCR premix (Takara Bio, #639298) and cloned into the Cla1 and XhoI sites of pAAV-MCS vector (Cell biolabs, #VPK-410) using the NEBuilder HiFi DNA Assembly Master Mix (New England Biolabs, #E2621).

Techniques: Control, Injection, Western Blot, Staining, Immunohistochemistry, Ubiquitin Proteomics, Cell Culture, Infection, Expressing, Two Tailed Test